Review



pcag nls ha bxb1 plasmid  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95

    Structured Review

    Addgene inc pcag nls ha bxb1 plasmid
    Pcag Nls Ha Bxb1 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 74 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcag+nls+ha+bxb1/pCAG-NLS-HA-Bxb1+(Plasmid+%2351271)/pm41787805-66-1-6
    Average 95 stars, based on 74 article reviews
    pcag nls ha bxb1 plasmid - by Bioz Stars, 2026-10
    95/100 stars

    Images

    Related Articles

    other:

    Article Title: Precise kilobase-scale genomic insertions in mammalian cells using PASTE.
    Article Snippet: Programmable gene integration technologies are an emerging modality with exciting applications in both basic research and therapeutic development.. Programmable addition via site-specific targeting elements (PASTE) is a programmable gene integration approach for precise and efficient programmable integration of large DNA sequences into the genome.. PASTE offers improved editing efficiency, purity and programmability compared with previous methods for long insertions into the mammalian genome.

    Transfection:

    Article Title: Viral transcriptional regulators extensively rewire host pathways through diverse mechanisms
    Article Snippet: .. At approximately ∼50% confluency, each well was transfected (using Lipofectamine 3000 in Opti-MEM) with 1,500 ng donor attB library, encoding each of the relevant vTR sequences, and 100 ng of pCAG-NLS-HA-Bxb1 (Addgene, 51271). ..

    Article Title: Multiplex design and discovery of proximity handles for programmable proteome editing
    Article Snippet: .. On day 1, cells were transfected with 20 μg of barcoded binder library ( ) and 3 μg pCAG-NLS-HA-Bxb1 (Addgene #51271) using Lipofectamine 3000 according to the manufacturers instructions, and the media was replaced with complete DMEM on day 2. .. Expression of genomically integrated binders was induced on day 3 by addition of doxycycline (Sigma-Aldrich #D9891) to a final concentration of 2 μg mL - .

    Article Title: The functional landscape of coding variation in the familial hypercholesterolemia gene LDLR
    Article Snippet: .. On day 1, cells were transfected (1) by electroporation with pCAG-NLS-HA-Bxb1 (Addgene #51271) and incubated for 2 days in standard conditions. ..

    Expressing:

    Article Title: Image-based, pooled phenotyping reveals multidimensional, disease-specific variant effects
    Article Snippet: RIPA buffer (Abcam, ab156034) Halt protease inhibitor cocktail (ThermoFisher, 1860932) BCA assay (ThermoFisher Pierce BCA protein assay kit, 23225) Laemmeli sample buffer (BioRad, 1610737) β-mercaptoethanol (BioRad, 1610710) 8–16% Criterion TGX Stain-Free Protein Gel (BioRad, 5678103) Tris/Glycine/SDS Running Buffer (BioRad, 1610732) Trans-Blot Turbo Midi 0.2 μm PVDF Transfer Packs (BioRad, 1704157) Bovine Serum Albumin (BSA; Sigma-Aldrich, A9418) Anti-phospho-AKT (Thr308) Rabbit mAb (CellSignal, 13038T) Anti-pan-AKT mouse mAb (Cell Signaling, 2920) Anti-PTEN rabbit mAb (Cell Signaling, 9559) Anti-lamin A/C mouse mAb (BioLegend, 600001) StarBright blue 520 goat anti-mouse IgG (BioRad, 12005866) StarBright blue 700 goat anti-rabbit IgG (BioRad, 12004162) hFAB rhodamine anti-actin primary antibody (BioRad, 12004164) .. pHSG299 (Takara Bio, 3299) pHR-UCOE-SFFV-Zim3-dCas9-P2A-EGFP (Addgene, 188899) piggyFlex (Addgene, 218234) lentiGuide-Puro (Addgene, 52963) pCAG-NLS-HA-Bxb1 (Addgene, 51271) Hyperactive piggyBac transposase expression vector (hyPBase; gift from Jay Shendure lab) pMD2.G (Addgene, 12259) psPAX2 (Addgene, 12260) .. mEGFP-HBBIVS2trunc-IRES-v1/v2N/v2C gene fragments (Twist, inquire for full sequence) PD-BsmBIsites gene fragment (Twist): gggagggggcgggaaaccgcctaaccatgccgagtgcggccgcGAGAAGGTCGGGTCCAGATATTGTAACTG TACGAAGACTGGGAGACGAGTGCCTGCAGGCATACGTCTCTCGATACTTGTTCGATCCTTC TAAGCTTGGCGTAACTAGATCTTGAGACTAGCTTTAAGGCCGGTCCTAGCAACGTATCTGTC GAGTAGAGTGTGGGCTCGTGGccgcggtcggcgtggactgtagaacactgccaatgccggtcccaagcccggataa aagtggagggtacags Prelamin A site-saturation library (positions 178-273; Twist SSVL, inquire for full sequence) PTEN site-saturation oligo library (positions 112-172; Twist, inquire for full sequence) PTEN_tile3_s1/2 gene blocks (Twist, inquire for full sequence) H1.4 oligo library (Twist, inquire for full sequence) H1.4_s1/2 gene blocks (Twist, inquire for full sequence) RPS19 oligo library (Twist, inquire for full sequence) RPS19_s1/2 gene blocks (Twist, inquire for full sequence) VISseq_GG_BColigo (IDT): GTATAGTTTGTGCGGTGGTCCGTCTCGACTGNNNNNNNNNNNNCGATCGAGACGCGAAGG TGTAGGGGATTGAT VISseq_GG_BColigoX2 (IDT): ACTTCCGTCTCGACTGNNNNNNNNCGATACTTGTTCGATCCTTCTAAGCTTGGCGTAACTAG ATCTTGATATCCAACTGTACGAAGACTGNNNNNNNNCGATCGAGACGCGAAC Lenti_GG_BColigo (IDT): ACTCGTCTCGGCTTAACTGTACGAAGACTGNNNNNNNNNNNNCGATACTTGTTCGATCCTT CTAAGCTTGGCGTAACTAGATCTTGACTGCGAGACGCTA LMNA -KO gRNA (Synthego): GGAGCUCAAUGAUCGCUUGG-(gRNA scaffold) PTEN -KO gRNA (Synthego): CCAAUUCAGGACCCACACGA-(gRNA scaffold)

    Plasmid Preparation:

    Article Title: Image-based, pooled phenotyping reveals multidimensional, disease-specific variant effects
    Article Snippet: RIPA buffer (Abcam, ab156034) Halt protease inhibitor cocktail (ThermoFisher, 1860932) BCA assay (ThermoFisher Pierce BCA protein assay kit, 23225) Laemmeli sample buffer (BioRad, 1610737) β-mercaptoethanol (BioRad, 1610710) 8–16% Criterion TGX Stain-Free Protein Gel (BioRad, 5678103) Tris/Glycine/SDS Running Buffer (BioRad, 1610732) Trans-Blot Turbo Midi 0.2 μm PVDF Transfer Packs (BioRad, 1704157) Bovine Serum Albumin (BSA; Sigma-Aldrich, A9418) Anti-phospho-AKT (Thr308) Rabbit mAb (CellSignal, 13038T) Anti-pan-AKT mouse mAb (Cell Signaling, 2920) Anti-PTEN rabbit mAb (Cell Signaling, 9559) Anti-lamin A/C mouse mAb (BioLegend, 600001) StarBright blue 520 goat anti-mouse IgG (BioRad, 12005866) StarBright blue 700 goat anti-rabbit IgG (BioRad, 12004162) hFAB rhodamine anti-actin primary antibody (BioRad, 12004164) .. pHSG299 (Takara Bio, 3299) pHR-UCOE-SFFV-Zim3-dCas9-P2A-EGFP (Addgene, 188899) piggyFlex (Addgene, 218234) lentiGuide-Puro (Addgene, 52963) pCAG-NLS-HA-Bxb1 (Addgene, 51271) Hyperactive piggyBac transposase expression vector (hyPBase; gift from Jay Shendure lab) pMD2.G (Addgene, 12259) psPAX2 (Addgene, 12260) .. mEGFP-HBBIVS2trunc-IRES-v1/v2N/v2C gene fragments (Twist, inquire for full sequence) PD-BsmBIsites gene fragment (Twist): gggagggggcgggaaaccgcctaaccatgccgagtgcggccgcGAGAAGGTCGGGTCCAGATATTGTAACTG TACGAAGACTGGGAGACGAGTGCCTGCAGGCATACGTCTCTCGATACTTGTTCGATCCTTC TAAGCTTGGCGTAACTAGATCTTGAGACTAGCTTTAAGGCCGGTCCTAGCAACGTATCTGTC GAGTAGAGTGTGGGCTCGTGGccgcggtcggcgtggactgtagaacactgccaatgccggtcccaagcccggataa aagtggagggtacags Prelamin A site-saturation library (positions 178-273; Twist SSVL, inquire for full sequence) PTEN site-saturation oligo library (positions 112-172; Twist, inquire for full sequence) PTEN_tile3_s1/2 gene blocks (Twist, inquire for full sequence) H1.4 oligo library (Twist, inquire for full sequence) H1.4_s1/2 gene blocks (Twist, inquire for full sequence) RPS19 oligo library (Twist, inquire for full sequence) RPS19_s1/2 gene blocks (Twist, inquire for full sequence) VISseq_GG_BColigo (IDT): GTATAGTTTGTGCGGTGGTCCGTCTCGACTGNNNNNNNNNNNNCGATCGAGACGCGAAGG TGTAGGGGATTGAT VISseq_GG_BColigoX2 (IDT): ACTTCCGTCTCGACTGNNNNNNNNCGATACTTGTTCGATCCTTCTAAGCTTGGCGTAACTAG ATCTTGATATCCAACTGTACGAAGACTGNNNNNNNNCGATCGAGACGCGAAC Lenti_GG_BColigo (IDT): ACTCGTCTCGGCTTAACTGTACGAAGACTGNNNNNNNNNNNNCGATACTTGTTCGATCCTT CTAAGCTTGGCGTAACTAGATCTTGACTGCGAGACGCTA LMNA -KO gRNA (Synthego): GGAGCUCAAUGAUCGCUUGG-(gRNA scaffold) PTEN -KO gRNA (Synthego): CCAAUUCAGGACCCACACGA-(gRNA scaffold)

    Article Title: KIF18A promotes chromosome congression in cooperation with CENP-E downstream of CENP-C
    Article Snippet: .. pCAG-NLS-HA-Bxb1 , Hermann et al. , Addgene plasmid, #51271. .. pCMV-VSV-G , Stewart et al. , Addgene plasmid, #8454.

    Article Title: HP1γ self-assembles and cooperates with KAP1 in repression of long noncoding RNA AI662270 in ESCs
    Article Snippet: .. pCAG-NLS-HA-Bxb1 , Addgene , Plasmid #51271. .. px459 , Addgene , Plasmid #62988.

    Electroporation:

    Article Title: The functional landscape of coding variation in the familial hypercholesterolemia gene LDLR
    Article Snippet: .. On day 1, cells were transfected (1) by electroporation with pCAG-NLS-HA-Bxb1 (Addgene #51271) and incubated for 2 days in standard conditions. ..

    Incubation:

    Article Title: The functional landscape of coding variation in the familial hypercholesterolemia gene LDLR
    Article Snippet: .. On day 1, cells were transfected (1) by electroporation with pCAG-NLS-HA-Bxb1 (Addgene #51271) and incubated for 2 days in standard conditions. ..



    Similar Products

    95
    Addgene inc pcag nls ha bxb1 plasmid
    Pcag Nls Ha Bxb1 Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcag+nls+ha+bxb1/pCAG-NLS-HA-Bxb1+(Plasmid+%2351271)/pm41787805-66-1-6
    Average 95 stars, based on 1 article reviews
    pcag nls ha bxb1 plasmid - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    95
    Addgene inc pcag nls ha bxb1
    Pcag Nls Ha Bxb1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcag+nls+ha+bxb1/pCAG-NLS-HA-Bxb1+(Plasmid+%2351271)/pmc13021124-91-0-2
    Average 95 stars, based on 1 article reviews
    pcag nls ha bxb1 - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    95
    Addgene inc bxb1 recombinase
    (A) AI662270 expression was measured in HP1α −/− , HP1β −/− , HP1γ −/− , and KAP1 −/− mouse ESCs using quantitative reverse transcription PCR (qRT-PCR). Data are presented as average between two independent biological replicates. (B) Generation of the entry mouse ESC line. The attP sequence (MIN tag) is inserted directly after the transcription start site of HP1γ. Schematic illustrating the CRISPR-Cas9-mediated genome editing strategy, with the gRNA and PAM sequences highlighted. The donor single-strand DNA contains the MIN tag sequence with a HincII restriction cut site for screening and homology arms flanking the translational start site. The positions of screening PCR primers are indicated, which produce 509 and 557 bp products in WT and HP1γ attP/attP cells, respectively. (C) PCR-based validation of two individual HP1γ attP/attP ESCs using primers indicated in (B), followed by HincII digestion. PCR products showing a reduced size after HincII digestion are considered positive. (D) Schematic outlining the <t>Bxb1-mediated</t> recombination strategy used to generate the HP1γ −/− ESC line. A cassette containing the attB site, RFP, a stop codon, and a polyA signal was inserted directly after the transcription start site by attP-attB recombination to produce HP1γ −/− ESCs. (E and F) Characterization of two individual HP1γ −/− ESC clones, A3 and C3, by quantitative RT-PCR analysis (E). Data are presented as mean ± standard deviation (SD) from three technical replicates. Western blot analysis to detect HP1γ in the two individual HP1γ −/− clones (F). The tubulin blot was used as a loading control. See also 1 and .
    Bxb1 Recombinase, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcag+nls+ha+bxb1/pCAG-NLS-HA-Bxb1+(Plasmid+%2351271)/pmc13021124-253-15-17
    Average 95 stars, based on 1 article reviews
    bxb1 recombinase - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    95
    Addgene inc plasmid
    (A) AI662270 expression was measured in HP1α −/− , HP1β −/− , HP1γ −/− , and KAP1 −/− mouse ESCs using quantitative reverse transcription PCR (qRT-PCR). Data are presented as average between two independent biological replicates. (B) Generation of the entry mouse ESC line. The attP sequence (MIN tag) is inserted directly after the transcription start site of HP1γ. Schematic illustrating the CRISPR-Cas9-mediated genome editing strategy, with the gRNA and PAM sequences highlighted. The donor single-strand DNA contains the MIN tag sequence with a HincII restriction cut site for screening and homology arms flanking the translational start site. The positions of screening PCR primers are indicated, which produce 509 and 557 bp products in WT and HP1γ attP/attP cells, respectively. (C) PCR-based validation of two individual HP1γ attP/attP ESCs using primers indicated in (B), followed by HincII digestion. PCR products showing a reduced size after HincII digestion are considered positive. (D) Schematic outlining the <t>Bxb1-mediated</t> recombination strategy used to generate the HP1γ −/− ESC line. A cassette containing the attB site, RFP, a stop codon, and a polyA signal was inserted directly after the transcription start site by attP-attB recombination to produce HP1γ −/− ESCs. (E and F) Characterization of two individual HP1γ −/− ESC clones, A3 and C3, by quantitative RT-PCR analysis (E). Data are presented as mean ± standard deviation (SD) from three technical replicates. Western blot analysis to detect HP1γ in the two individual HP1γ −/− clones (F). The tubulin blot was used as a loading control. See also 1 and .
    Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcag+nls+ha+bxb1/pCAG-NLS-HA-Bxb1+(Plasmid+%2351271)/pmc13021124-91-4-2
    Average 95 stars, based on 1 article reviews
    plasmid - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    95
    Addgene inc pfl9 pcag nls ha bxb1
    (A) AI662270 expression was measured in HP1α −/− , HP1β −/− , HP1γ −/− , and KAP1 −/− mouse ESCs using quantitative reverse transcription PCR (qRT-PCR). Data are presented as average between two independent biological replicates. (B) Generation of the entry mouse ESC line. The attP sequence (MIN tag) is inserted directly after the transcription start site of HP1γ. Schematic illustrating the CRISPR-Cas9-mediated genome editing strategy, with the gRNA and PAM sequences highlighted. The donor single-strand DNA contains the MIN tag sequence with a HincII restriction cut site for screening and homology arms flanking the translational start site. The positions of screening PCR primers are indicated, which produce 509 and 557 bp products in WT and HP1γ attP/attP cells, respectively. (C) PCR-based validation of two individual HP1γ attP/attP ESCs using primers indicated in (B), followed by HincII digestion. PCR products showing a reduced size after HincII digestion are considered positive. (D) Schematic outlining the <t>Bxb1-mediated</t> recombination strategy used to generate the HP1γ −/− ESC line. A cassette containing the attB site, RFP, a stop codon, and a polyA signal was inserted directly after the transcription start site by attP-attB recombination to produce HP1γ −/− ESCs. (E and F) Characterization of two individual HP1γ −/− ESC clones, A3 and C3, by quantitative RT-PCR analysis (E). Data are presented as mean ± standard deviation (SD) from three technical replicates. Western blot analysis to detect HP1γ in the two individual HP1γ −/− clones (F). The tubulin blot was used as a loading control. See also 1 and .
    Pfl9 Pcag Nls Ha Bxb1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcag+nls+ha+bxb1/pCAG-NLS-HA-Bxb1+(Plasmid+%2351271)/bio_rxiv__64898__2026__02__16__706221-176-20-21
    Average 95 stars, based on 1 article reviews
    pfl9 pcag nls ha bxb1 - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    95
    Addgene inc pcag nls habxb1
    (A) AI662270 expression was measured in HP1α −/− , HP1β −/− , HP1γ −/− , and KAP1 −/− mouse ESCs using quantitative reverse transcription PCR (qRT-PCR). Data are presented as average between two independent biological replicates. (B) Generation of the entry mouse ESC line. The attP sequence (MIN tag) is inserted directly after the transcription start site of HP1γ. Schematic illustrating the CRISPR-Cas9-mediated genome editing strategy, with the gRNA and PAM sequences highlighted. The donor single-strand DNA contains the MIN tag sequence with a HincII restriction cut site for screening and homology arms flanking the translational start site. The positions of screening PCR primers are indicated, which produce 509 and 557 bp products in WT and HP1γ attP/attP cells, respectively. (C) PCR-based validation of two individual HP1γ attP/attP ESCs using primers indicated in (B), followed by HincII digestion. PCR products showing a reduced size after HincII digestion are considered positive. (D) Schematic outlining the <t>Bxb1-mediated</t> recombination strategy used to generate the HP1γ −/− ESC line. A cassette containing the attB site, RFP, a stop codon, and a polyA signal was inserted directly after the transcription start site by attP-attB recombination to produce HP1γ −/− ESCs. (E and F) Characterization of two individual HP1γ −/− ESC clones, A3 and C3, by quantitative RT-PCR analysis (E). Data are presented as mean ± standard deviation (SD) from three technical replicates. Western blot analysis to detect HP1γ in the two individual HP1γ −/− clones (F). The tubulin blot was used as a loading control. See also 1 and .
    Pcag Nls Habxb1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcag+nls+ha+bxb1/pCAG-NLS-HA-Bxb1+(Plasmid+%2351271)/bio_rxiv__64898__2026__02__09__704749-198-12-13
    Average 95 stars, based on 1 article reviews
    pcag nls habxb1 - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    95
    Addgene inc pcag nls bxb1
    (A) AI662270 expression was measured in HP1α −/− , HP1β −/− , HP1γ −/− , and KAP1 −/− mouse ESCs using quantitative reverse transcription PCR (qRT-PCR). Data are presented as average between two independent biological replicates. (B) Generation of the entry mouse ESC line. The attP sequence (MIN tag) is inserted directly after the transcription start site of HP1γ. Schematic illustrating the CRISPR-Cas9-mediated genome editing strategy, with the gRNA and PAM sequences highlighted. The donor single-strand DNA contains the MIN tag sequence with a HincII restriction cut site for screening and homology arms flanking the translational start site. The positions of screening PCR primers are indicated, which produce 509 and 557 bp products in WT and HP1γ attP/attP cells, respectively. (C) PCR-based validation of two individual HP1γ attP/attP ESCs using primers indicated in (B), followed by HincII digestion. PCR products showing a reduced size after HincII digestion are considered positive. (D) Schematic outlining the <t>Bxb1-mediated</t> recombination strategy used to generate the HP1γ −/− ESC line. A cassette containing the attB site, RFP, a stop codon, and a polyA signal was inserted directly after the transcription start site by attP-attB recombination to produce HP1γ −/− ESCs. (E and F) Characterization of two individual HP1γ −/− ESC clones, A3 and C3, by quantitative RT-PCR analysis (E). Data are presented as mean ± standard deviation (SD) from three technical replicates. Western blot analysis to detect HP1γ in the two individual HP1γ −/− clones (F). The tubulin blot was used as a loading control. See also 1 and .
    Pcag Nls Bxb1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcag+nls+ha+bxb1/pCAG-NLS-HA-Bxb1+(Plasmid+%2351271)/pmc12880521-282-10-11
    Average 95 stars, based on 1 article reviews
    pcag nls bxb1 - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    95
    Addgene inc recombinase bxb1
    (A) Schematic illustration of the expression system. For single copy expression, a plasmid (vector DNA) encoding GFP-Parkin followed by an internal ribosomal entry site (IRES) and mCherry, was introduced into the landing pad in the HEK293T genome (gDNA) by <t>Bxb1</t> site-specific recombination. This displaces the cassette of BFP-iCasp9-BlastR separated by 2A stop/start sites (arrowheads). The expressed GFP-tagged Parkin protein variant is subject to PQC degradation (Pacman) resulting in reduced GFP fluorescence, while the mCherry level is constant. Created in BioRender. Hartmann-Petersen, R. (2025) https://BioRender.com/m5by8sy . (B) Comparison of protein levels of wild type Parkin, the R42P variant and empty vector (EV) by SDS-PAGE and western blotting of whole cell lysates. mCherry and β-actin were included as controls. (C) Representative flow cytometry profiles for landing pad cells expressing Parkin wild-type (n = 9.8×10 3 ) and R42P (n = 1×10 4 ) treated with 10 µM bortezomib (BZ) for 16 hours. Untreated wild-type (n = 9.7×10 3 ) and R42P (n = 1×10 4 ) cells are included for comparison. (D) Representative flow cytometry profiles for landing pad cells expressing Parkin wild-type (n = 9.5×10 3 ) and R42P (n = 1×10 4 ) treated with 1 µM TAK243 for 6 hours. The untreated cells (from panel C) are included for comparison.
    Recombinase Bxb1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/pcag+nls+ha+bxb1/pCAG-NLS-HA-Bxb1+(Plasmid+%2351271)/bio_rxiv__64898__2026__02__04__703735-139-1-7
    Average 95 stars, based on 1 article reviews
    recombinase bxb1 - by Bioz Stars, 2026-10
    95/100 stars
      Buy from Supplier

    Image Search Results


    (A) AI662270 expression was measured in HP1α −/− , HP1β −/− , HP1γ −/− , and KAP1 −/− mouse ESCs using quantitative reverse transcription PCR (qRT-PCR). Data are presented as average between two independent biological replicates. (B) Generation of the entry mouse ESC line. The attP sequence (MIN tag) is inserted directly after the transcription start site of HP1γ. Schematic illustrating the CRISPR-Cas9-mediated genome editing strategy, with the gRNA and PAM sequences highlighted. The donor single-strand DNA contains the MIN tag sequence with a HincII restriction cut site for screening and homology arms flanking the translational start site. The positions of screening PCR primers are indicated, which produce 509 and 557 bp products in WT and HP1γ attP/attP cells, respectively. (C) PCR-based validation of two individual HP1γ attP/attP ESCs using primers indicated in (B), followed by HincII digestion. PCR products showing a reduced size after HincII digestion are considered positive. (D) Schematic outlining the Bxb1-mediated recombination strategy used to generate the HP1γ −/− ESC line. A cassette containing the attB site, RFP, a stop codon, and a polyA signal was inserted directly after the transcription start site by attP-attB recombination to produce HP1γ −/− ESCs. (E and F) Characterization of two individual HP1γ −/− ESC clones, A3 and C3, by quantitative RT-PCR analysis (E). Data are presented as mean ± standard deviation (SD) from three technical replicates. Western blot analysis to detect HP1γ in the two individual HP1γ −/− clones (F). The tubulin blot was used as a loading control. See also 1 and .

    Journal: Cell reports

    Article Title: HP1γ self-assembles and cooperates with KAP1 in repression of long noncoding RNA AI662270 in ESCs

    doi: 10.1016/j.celrep.2025.116874

    Figure Lengend Snippet: (A) AI662270 expression was measured in HP1α −/− , HP1β −/− , HP1γ −/− , and KAP1 −/− mouse ESCs using quantitative reverse transcription PCR (qRT-PCR). Data are presented as average between two independent biological replicates. (B) Generation of the entry mouse ESC line. The attP sequence (MIN tag) is inserted directly after the transcription start site of HP1γ. Schematic illustrating the CRISPR-Cas9-mediated genome editing strategy, with the gRNA and PAM sequences highlighted. The donor single-strand DNA contains the MIN tag sequence with a HincII restriction cut site for screening and homology arms flanking the translational start site. The positions of screening PCR primers are indicated, which produce 509 and 557 bp products in WT and HP1γ attP/attP cells, respectively. (C) PCR-based validation of two individual HP1γ attP/attP ESCs using primers indicated in (B), followed by HincII digestion. PCR products showing a reduced size after HincII digestion are considered positive. (D) Schematic outlining the Bxb1-mediated recombination strategy used to generate the HP1γ −/− ESC line. A cassette containing the attB site, RFP, a stop codon, and a polyA signal was inserted directly after the transcription start site by attP-attB recombination to produce HP1γ −/− ESCs. (E and F) Characterization of two individual HP1γ −/− ESC clones, A3 and C3, by quantitative RT-PCR analysis (E). Data are presented as mean ± standard deviation (SD) from three technical replicates. Western blot analysis to detect HP1γ in the two individual HP1γ −/− clones (F). The tubulin blot was used as a loading control. See also 1 and .

    Article Snippet: 2 × 10 5 entry HP1γ attP/attP cells were co-transfected with the attB-RFP-Stop-PolyA construct and Bxb1 recombinase (Addgene, #51271).

    Techniques: Expressing, Reverse Transcription, Quantitative RT-PCR, Sequencing, CRISPR, Biomarker Discovery, Clone Assay, Standard Deviation, Western Blot, Control

    (A) Schematic illustration of the expression system. For single copy expression, a plasmid (vector DNA) encoding GFP-Parkin followed by an internal ribosomal entry site (IRES) and mCherry, was introduced into the landing pad in the HEK293T genome (gDNA) by Bxb1 site-specific recombination. This displaces the cassette of BFP-iCasp9-BlastR separated by 2A stop/start sites (arrowheads). The expressed GFP-tagged Parkin protein variant is subject to PQC degradation (Pacman) resulting in reduced GFP fluorescence, while the mCherry level is constant. Created in BioRender. Hartmann-Petersen, R. (2025) https://BioRender.com/m5by8sy . (B) Comparison of protein levels of wild type Parkin, the R42P variant and empty vector (EV) by SDS-PAGE and western blotting of whole cell lysates. mCherry and β-actin were included as controls. (C) Representative flow cytometry profiles for landing pad cells expressing Parkin wild-type (n = 9.8×10 3 ) and R42P (n = 1×10 4 ) treated with 10 µM bortezomib (BZ) for 16 hours. Untreated wild-type (n = 9.7×10 3 ) and R42P (n = 1×10 4 ) cells are included for comparison. (D) Representative flow cytometry profiles for landing pad cells expressing Parkin wild-type (n = 9.5×10 3 ) and R42P (n = 1×10 4 ) treated with 1 µM TAK243 for 6 hours. The untreated cells (from panel C) are included for comparison.

    Journal: bioRxiv

    Article Title: BAG6 and RNF126 are broadly involved in protein quality control of non-native missense protein variants

    doi: 10.64898/2026.02.04.703735

    Figure Lengend Snippet: (A) Schematic illustration of the expression system. For single copy expression, a plasmid (vector DNA) encoding GFP-Parkin followed by an internal ribosomal entry site (IRES) and mCherry, was introduced into the landing pad in the HEK293T genome (gDNA) by Bxb1 site-specific recombination. This displaces the cassette of BFP-iCasp9-BlastR separated by 2A stop/start sites (arrowheads). The expressed GFP-tagged Parkin protein variant is subject to PQC degradation (Pacman) resulting in reduced GFP fluorescence, while the mCherry level is constant. Created in BioRender. Hartmann-Petersen, R. (2025) https://BioRender.com/m5by8sy . (B) Comparison of protein levels of wild type Parkin, the R42P variant and empty vector (EV) by SDS-PAGE and western blotting of whole cell lysates. mCherry and β-actin were included as controls. (C) Representative flow cytometry profiles for landing pad cells expressing Parkin wild-type (n = 9.8×10 3 ) and R42P (n = 1×10 4 ) treated with 10 µM bortezomib (BZ) for 16 hours. Untreated wild-type (n = 9.7×10 3 ) and R42P (n = 1×10 4 ) cells are included for comparison. (D) Representative flow cytometry profiles for landing pad cells expressing Parkin wild-type (n = 9.5×10 3 ) and R42P (n = 1×10 4 ) treated with 1 µM TAK243 for 6 hours. The untreated cells (from panel C) are included for comparison.

    Article Snippet: The recombinase Bxb1 was expressed from pCAG-NLS-HABxb1 (Addgene #51271) ( ).

    Techniques: Expressing, Plasmid Preparation, Variant Assay, Fluorescence, Comparison, SDS Page, Western Blot, Flow Cytometry